Sequence ID | >W1810787192 |
Genome ID | QRDN01000001 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Muricauda sp. ARW7G5W [QRDN] |
Start position on genome | 655928 |
End posion on genome | 655857 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
actcctgtat |
tRNA gene sequence |
GGCATCGTGGCCGAGTGGCTAGGCACAGCTCTGCAAAAGCTTGTACAGCGGTTCGAATCC |
Downstream region at tRNA end position |
aaaacccaac |
Secondary structure (Cloverleaf model) | >W1810787192 Cys GCA t TCaa aaaacccaac G - C G - C C - G A - T T - A C - G G - C T A T T C G C C A G A G | | | | | G T G C C G A G C G G C G | | | T T G A G G C C T A GTAC C T A - T G - C C - G T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |