Sequence ID | >W1810793640 |
Genome ID | QRJV01000019 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Phocaeicola vulgatus AM17-30 [QRJV] |
Start position on genome | 13683 |
End posion on genome | 13754 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
acataatgat |
tRNA gene sequence |
TGGACTATGGTGTAATGGTAGCACAACAGGTTTTGGTTCTGTTTGTCCAAGTTCGAATCT |
Downstream region at tRNA end position |
ttttcaatcc |
Secondary structure (Cloverleaf model) | >W1810793640 Gln TTG t ACag ttttcaatcc T - A G - C G - C A - T C - G T - A A - T T A T G G T T C A A A G | | | | | G T T G T G C C A A G C G + | | | T T G G C A C T A A TTGT A - T C - G A - T G - C G + T T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |