Sequence ID | >W1810800489 |
Genome ID | QROR01000031 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Ruminococcus sp. AF37-6AT [QROR] |
Start position on genome | 553 |
End posion on genome | 467 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
aacaatatat |
tRNA gene sequence |
GGAGAGATATCGAAGTGGTCATAACGAGGCGGTCTTGAAAACCGTTTGTCCGCAAGGGCG |
Downstream region at tRNA end position |
gtcaggttcg |
Secondary structure (Cloverleaf model) | >W1810800489 Ser TGA t GCta gtcaggttcg G - C G - C A - T G - C A - T G - C A - T T A T C A C C C A G T G A A | | | | | G G A G C T G T G G G C T | | | T T C A C G A A T A G TTGTCCGCAAGGGCGC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |