Sequence ID | >W1810801395 |
Genome ID | QRPH01000005 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium pseudocatenulatum AF36-12AT [QRPH] |
Start position on genome | 127134 |
End posion on genome | 127208 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
caaaaacatg |
tRNA gene sequence |
GTGGCTATAGCTCAGTTGGTAGAGCATCTGATTGTGGTTCAGAAGGTCGCGCGTTCGAGC |
Downstream region at tRNA end position |
gtagagacct |
Secondary structure (Cloverleaf model) | >W1810801395 His GTG g CCCg gtagagacct G - C T - A G - C G - C C - G T - A A - T C G T T G C G C A T G A A + | | | | G T C T C G G C G C G C G | | | | T T G G A G C T A A AGGTC T - A C - G T - A G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |