Sequence ID | >W1810807743 |
Genome ID | QRVN01000002 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Segatella copri AF22-1 [QRVN] |
Start position on genome | 155470 |
End posion on genome | 155543 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
aaagcaagat |
tRNA gene sequence |
GGTGCCATAGCTCAGTTGGTAGAGCAAAGGACTGAAAATCCTTGTGTCCCCGGTTCGATT |
Downstream region at tRNA end position |
ctcctttcat |
Secondary structure (Cloverleaf model) | >W1810807743 Phe GAA t ACtc ctcctttcat G - C G - C T - A G + T C - G C - G A - T T T T G G T C C A T G A A | | | | G T C T C G C C C G G C G | | | | T T G G A G C T A A GTGTC A - T A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |