Sequence ID | >W1810810118 |
Genome ID | QRXG01000005 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Agathobacter rectalis AF18-16LB [QRXG] |
Start position on genome | 6541 |
End posion on genome | 6613 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
tataatacac |
tRNA gene sequence |
GGTTCGTTGGTCAAGCGGTTAAGACGCCGCCCTCTCACGGCGGAAACACGGGTTCGATTC |
Downstream region at tRNA end position |
agtatttaaa |
Secondary structure (Cloverleaf model) | >W1810810118 Glu CTC c GCta agtatttaaa G + T G - C T - A T + G C - G G - C T - A T T T T G C C C A C G A G | | | | | G G A C T G A C G G G C G | | | T T T A G A C T A G AAAC C - G C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |