Sequence ID | >W1810813295 |
Genome ID | QRZM01000023 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Enterocloster bolteae AF14-18 [QRZM] |
Start position on genome | 120 |
End posion on genome | 191 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tgtactaaat |
tRNA gene sequence |
GCGCGAGTGGCTCAGGGGTGGAGCACCACCTTGCCAAGGTGGGGGCCGCGGGTTCGAATC |
Downstream region at tRNA end position |
ttgttttatt |
Secondary structure (Cloverleaf model) | >W1810813295 Gly GCC t Tttt ttgttttatt G - C C - G G - C C - G G - C A - T G - C T A T T G C C C A G A G + | | | | G G C T C G G C G G G C G | | | | T T G G A G C T G A GGGCC C - G C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |