Sequence ID | >W1810822525 |
Genome ID | QSGF01000011 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Agathobacter rectalis AM42-1 [QSGF] |
Start position on genome | 42100 |
End posion on genome | 42028 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
tgtgagacaa |
tRNA gene sequence |
GCCCAGTTAGCTCAGTTGGTAGAGCAACGGACTGAAAATCCGTGTGTCTCTGGTTCGATT |
Downstream region at tRNA end position |
tacaacaaat |
Secondary structure (Cloverleaf model) | >W1810822525 Phe GAA a Atta tacaacaaat G - C C - G C - G C - G A - T G - C T - A T T T A G G C C A T G A A | | + | | G T C T C G T C T G G C G | | | | T T G G A G C T A A GTGTC A - T C - G G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |