Sequence ID | >W1810829339 |
Genome ID | QSKZ01000002 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Bacteroides salyersiae AM26-2AC [QSKZ] |
Start position on genome | 621684 |
End posion on genome | 621757 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
aataaggatt |
tRNA gene sequence |
GATTCAGTAGCTCAGCAGGTAGAGCACAACACTTTTAATGTTGGGGTCCTGGGTTCGAGC |
Downstream region at tRNA end position |
aaaattagag |
Secondary structure (Cloverleaf model) | >W1810829339 Lys TTT t ACtg aaaattagag G - C A - T T - A T + G C - G A - T G - C C G T G A C C C A C G A A | | | | | G A C T C G C T G G G C G | | | | T T G G A G C T A A GGGTC C - G A - T A - T C - G A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |