| Sequence ID | >SRA1009832 |
| Genome ID | SRR020491.370581 |
| Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
| Species | |
|
Start position on genome
|
173
|
|
End posion on genome
|
101
|
|
Amino Acid
|
Thr
|
|
Anticodon
|
TGT
|
|
Upstream region at tRNA start position
|
nnnnnnnnnn
|
|
tRNA gene sequence
|
GCCCCGGTGGCGCAACGGTAGCGCAGTCGATTTGTAATCGACAGGTTAGGGGTTCGACTC CCCTCTGGGGCTCtc
|
|
Downstream region at tRNA end position
|
tccagcggtt
|
| Secondary structure (Cloverleaf model) | >SRA1009832 Thr TGT
n TCtc tccagcggtt
G - C
C - G
C - G
C - G
C - G
G + T
G - C T C
T T C C C C A
A A G | | | | | G
C C G C G A G G G G C
G | | | | T T
G G C G C
T A A AGGTT
G - C
T - A
C - G
G - C
A - T
T A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |