| Sequence ID | >W1810834429 |
| Genome ID | QSQL01000018 |
| Phylum/Class | Bacteroidota |
| Species | Parabacteroides sp. 20_3 20_3 TF12-11 [QSQL] |
| Start position on genome | 81471 |
| End posion on genome | 81398 |
| Amino Acid | Trp |
| Anticodon | CCA |
| Upstream region at tRNA start position |
ggctatttct |
| tRNA gene sequence |
ACGGAAGTAGCTCAGTCGGTAGAGCACTGGTCTCCAAAACCAGGTGTCGGGAGTTCGAGC |
| Downstream region at tRNA end position |
aaatctatag |
| Secondary structure (Cloverleaf model) | >W1810834429 Trp CCA
t GCta aaatctatag
A - T
C - G
G - C
G - C
A - T
A - T
G - C C G
T C T C T C A
T G A A | + | | | G
C C T C G G G G A G C
G | | | | T T
G G A G C
T A A GTGTC
C - G
T - A
G - C
G - C
T - A
C A
T A
C C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |