Sequence ID | >W1810842805 |
Genome ID | QSWF01000001 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Parabacteroides gordonii OM02-37 [QSWF] |
Start position on genome | 517128 |
End posion on genome | 517054 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
tatttgtttt |
tRNA gene sequence |
GGTTCGGTAGTTCAGTTGGTTAGAATACATGCCTGTCACGCATGGGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
tcgaagaaag |
Secondary structure (Cloverleaf model) | >W1810842805 Asp GTC t GCtt tcgaagaaag G - C G - C T - A T + G C - G G - C G - C T G T T G C C C A T G A A + | | | | G T C T T G G C G G G C G | | | + T T G G A A T T T A A GGGTC C - G A - T T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |