Sequence ID | >W1810861075 |
Genome ID | QTTP01000001 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Rhodococcus wratislaviensis WS3308 [QTTP] |
Start position on genome | 6826446 |
End posion on genome | 6826373 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
gcaagagcga |
tRNA gene sequence |
GCGCCTATAGCTCAGTTGGTAGAGCAAGTGACTCTTAATCACTGGGTCCGGGGTTCGAGT |
Downstream region at tRNA end position |
gcacgaaggc |
Secondary structure (Cloverleaf model) | >W1810861075 Lys CTT a ACtt gcacgaaggc G - C C - G G - C C - G C - G T + G A - T T G T G T C C C A T G A A | + | | | G T C T C G C G G G G C G | | | | T T G G A G C T A A GGGTC A - T G - C T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |