Sequence ID | >W1810861610 |
Genome ID | QTTZ01000001 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Microbacterium trichothecenolyticum ZKA46 [QTTZ] |
Start position on genome | 3903793 |
End posion on genome | 3903867 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ggatgtgttt |
tRNA gene sequence |
GGCAGGGTAGCTCAGTTGGTGAGAGCGCACGACTCATAATCGTGAGGTCGCGGGTTCAAG |
Downstream region at tRNA end position |
atagaatcct |
Secondary structure (Cloverleaf model) | >W1810861610 Met CAT t ACag atagaatcct G + T G - C C - G A - T G - C G - C G + T C G T C G C C C A T G A A | | | | | A T C T C G G C G G G C G | | | | T T G G A G C T G A G AGGTC C - G A - T C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |