| Sequence ID | >SRA1010142 |
| Genome ID | SRR020491.470243 |
| Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
| Species | |
|
Start position on genome
|
172
|
|
End posion on genome
|
247
|
|
Amino Acid
|
Ala
|
|
Anticodon
|
GGC
|
|
Upstream region at tRNA start position
|
cgactcgtgt
|
|
tRNA gene sequence
|
GGGGCTGTAGCTCATCTGGGAGAGCGCTTCAATGGCATTGAAGAGGTACGGGGTTCGAGT CCCCGCAGCTCCACCA
|
|
Downstream region at tRNA end position
|
cccacacacc
|
| Secondary structure (Cloverleaf model) | >SRA1010142 Ala GGC
t ACCA cccacacacc
G - C
G - C
G + T
G - C
C - G
T - A
G - C T G
T G C C C C A
C T A A | | | | | G
T C T C G C G G G G C
G | | | | T T
G G A G C
G A G AGGTA
C - G
T - A
T - A
C - G
A - T
A T
T A
G G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |