Sequence ID | >W1810870198 |
Genome ID | QUAK01000215 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Streptomyces triticagri NEAU-YY421 [QUAK] |
Start position on genome | 11972 |
End posion on genome | 11899 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gcgccgaccc |
tRNA gene sequence |
GCCCCCGTAGCTCAGGGGATAGAGCAACGGTCTCCGGAACCGTGTGCGCAGGTTCGAATC |
Downstream region at tRNA end position |
caggacggaa |
Secondary structure (Cloverleaf model) | >W1810870198 Arg CCG c ACCg caggacggaa G - C C - G C - G C - G C - G C - G G - C T A T C G T C C A G G A A | | | | | G G C T C G G C A G G C G | | | | T T A G A G C T A A GTGC A - T C - G G - C G - C T - A C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |