| Sequence ID | >W1810872825 |
| Genome ID | QUEA01000021 |
| Phylum/Class | Bacillota |
| Species | Coprobacillus sp. AF34-1BH [QUEA] |
| Start position on genome | 15831 |
| End posion on genome | 15906 |
| Amino Acid | Lys |
| Anticodon | TTT |
| Upstream region at tRNA start position |
catatttatt |
| tRNA gene sequence |
GACCCGCTAGCTCAGTTGGTAGAGCATCTGACTTTTAATCAGAGGGTCAGGCGTTCGAGT |
| Downstream region at tRNA end position |
tttctatgcg |
| Secondary structure (Cloverleaf model) | >W1810872825 Lys TTT
t ACCA tttctatgcg
G - C
A - T
C - G
C - G
C - G
G - C
C - G T G
T T C C G C A
T G A A | | | | | G
T C T C G A G G C G C
G | | | | T T
G G A G C
T A A GGGTC
T - A
C - G
T - A
G - C
A - T
C A
T A
T T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |