| Sequence ID | >W1810875285 |
| Genome ID | QUFV01000003 |
| Phylum/Class | Bacillota |
| Species | Clostridium sp. AF23-8 [QUFV] |
| Start position on genome | 5595 |
| End posion on genome | 5508 |
| Amino Acid | Ser |
| Anticodon | TGA |
| Upstream region at tRNA start position |
attaaaataT |
| tRNA gene sequence |
GGAGAGGTATCGAAGTGGTCATAACGAGGCGGTCTTGAAAACCGTTTGTCCGCAAGGGCG |
| Downstream region at tRNA end position |
gatacattcg |
| Secondary structure (Cloverleaf model) | >W1810875285 Ser TGA
T GTtc gatacattcg
G - C
G - C
A - T
G - C
A - T
G - C
G - C T A
T C A C C C A
G T G A A | | | | | G
G A G C T G T G G G C
T | | | T T
C A C G A
A T A G TTGTCCGCAAGGGCGC
G + T
C - G
G - C
G - C
T - A
C A
T A
T G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |