| Sequence ID | >W1810883028 |
| Genome ID | QULM01000007 |
| Phylum/Class | Bacillota |
| Species | Coprococcus sp. OM04-5BH [QULM] |
| Start position on genome | 112220 |
| End posion on genome | 112148 |
| Amino Acid | Trp |
| Anticodon | CCA |
| Upstream region at tRNA start position |
ttttgtataT |
| tRNA gene sequence |
AGGGGATTGGTCAAATGGTATGATAGGGGTCTCCAAAACCTTTGGTGGGAGTTCGATTCT |
| Downstream region at tRNA end position |
taaagccttg |
| Secondary structure (Cloverleaf model) | >W1810883028 Trp CCA
T GTtt taaagccttg
A - T
G - C
G - C
G - C
G - C
A - T
T - A T T
T C T C T C A
A A G | + | | | G
T A C T G G G G A G C
G | | | + T T
G T G A T
T A A TGGT
G + T
G + T
G - C
G - C
T - A
C A
T A
C C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |