Sequence ID | >W1810883347 |
Genome ID | QULT01000002 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Roseburia sp. OM04-10AA [QULT] |
Start position on genome | 142679 |
End posion on genome | 142596 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gtatagaaaT |
tRNA gene sequence |
GGGCAGATTCCCGAGTGGCCAAAGGGGACAGACTGTAAATCTGCTGCAAATTGCTTCGGT |
Downstream region at tRNA end position |
ttctttttag |
Secondary structure (Cloverleaf model) | >W1810883347 Tyr GTA T ATtc ttctttttag G - C G - C G - C C - G A - T G - C A - T T A T C C A C C A T G A T | | | | | G G G C C C G G T G G C G | | | T T C A G G G C A A G TGCAAATTGCTTC A C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |