Sequence ID | >W1810883733 |
Genome ID | QUMA01000004 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Blautia sp. OF11-22 [QUMA] |
Start position on genome | 161715 |
End posion on genome | 161641 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
acactgatgT |
tRNA gene sequence |
GGGGTCTTAGCTCAGCTGGGAGAGCATCTGCCTTACAAGCAGAGGGTCATAGGTTCGAGC |
Downstream region at tRNA end position |
tttatgaaaa |
Secondary structure (Cloverleaf model) | >W1810883733 Val TAC T ATat tttatgaaaa G - C G - C G - C G - C T + G C - G T - A C G T T A T C C A C G A A | | | | | G T C T C G A T A G G C G | | | | T T G G A G C G A A GGGTC T - A C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |