Sequence ID | >W1810886083 |
Genome ID | QUNU01000005 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Duganella sp. GV067 [QUNU] |
Start position on genome | 321210 |
End posion on genome | 321294 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
aaactacaat |
tRNA gene sequence |
GCCCACGTGGCGGAATTGGTAGACGCGCATGGTTCAGGTCCATGTGCCGCAAGGTGTGGG |
Downstream region at tRNA end position |
aaaattccgc |
Secondary structure (Cloverleaf model) | >W1810886083 Leu CAG t ACCA aaaattccgc G - C C - G C - G C - G A - T C - G G - C T G T C T C C C A T A A G | + | | | G T G G C G G G G G G C G | | | T T G A C G C T A G G TGCCGCAAGGTGT C - G A - T T - A G - C G - C T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |