| Sequence ID | >SRA1010397 |
| Genome ID | SRR020492.41161 |
| Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
| Species | |
|
Start position on genome
|
153
|
|
End posion on genome
|
227
|
|
Amino Acid
|
Thr
|
|
Anticodon
|
GGT
|
|
Upstream region at tRNA start position
|
gagttttaaa
|
|
tRNA gene sequence
|
GCCTGGGTAGCTCAGTGGTAGAGCGTTTCCTTGGTAAGGAAGAGGTCGGCAGTTCAATCC TGCTCTCAGGCTCCA
|
|
Downstream region at tRNA end position
|
atttttttag
|
| Secondary structure (Cloverleaf model) | >SRA1010397 Thr GGT
a TCCA atttttttag
G - C
C - G
C - G
T - A
G - C
G + T
G - C C T
T T C G T C A
G A A + | | | | A
T C T C G G G C A G C
G | | | | T T
G G A G C
T A G AGGTC
T + G
T - A
T - A
C - G
C - G
T A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |