Sequence ID | >W1810894079 |
Genome ID | QUWS01000007 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Acinetobacter sp. SWAC57 [QUWS] |
Start position on genome | 92112 |
End posion on genome | 92036 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ggtattttta |
tRNA gene sequence |
GGGCCTATAGCTCAGTTGGTTAGAGCAGCGGACTCATAATCCGTTGGTCCACAGTTCAAG |
Downstream region at tRNA end position |
tataaaacaa |
Secondary structure (Cloverleaf model) | >W1810894079 Met CAT a ACCA tataaaacaa G - C G - C G - C C - G C - G T + G A - T T G T G T G T C A T G A A | | | | | A T C T C G C A C A G C G | | | | T T G G A G C T T A A TGGTC G + T C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |