Sequence ID | >W1810908254 |
Genome ID | QVIN01000006 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Duganella sp. BJB480 [QVIN] |
Start position on genome | 385686 |
End posion on genome | 385761 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gttgttcgca |
tRNA gene sequence |
GTCCCCATCGTCTAGAGGCCTAGGACATCACCCTTTCACGGTGAGTACGGGGGTTCGAAT |
Downstream region at tRNA end position |
agttgtagat |
Secondary structure (Cloverleaf model) | >W1810908254 Glu TTC a GCCA agttgtagat G - C T - A C - G C - G C - G C - G A - T T A T C C C C C A A G A C | | | | | G G T C T G G G G G G C G + | | | T T C G G A C C T A A GTAC T - A C - G A - T C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |