| Sequence ID | >SRA1010849 |
| Genome ID | SRR020492.193603 |
| Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
| Species | |
|
Start position on genome
|
10
|
|
End posion on genome
|
82
|
|
Amino Acid
|
Glu
|
|
Anticodon
|
CTC
|
|
Upstream region at tRNA start position
|
nccccagcat
|
|
tRNA gene sequence
|
GGCGCGTTCGTCTAGGGGTCAGGACGCCGGCCTCTCAAGCCGGTAACACGTGTTCAAATC CCGTACGCGCTACag
|
|
Downstream region at tRNA end position
|
gcaacacatt
|
| Secondary structure (Cloverleaf model) | >SRA1010849 Glu CTC
t ACag gcaacacatt
G + T
G - C
C - G
G - C
C - G
G - C
T - A T A
T T G C C C A
G G A C | | | | A
G T C T G A C G T G C
G + | | | T T
T G G A C
C A G TAAC
C - G
C - G
G - C
G - C
C - G
C A
T A
C T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |