| Sequence ID | >SRA1011023 |
| Genome ID | SRR020492.254775 |
| Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
| Species | |
|
Start position on genome
|
184
|
|
End posion on genome
|
92
|
|
Amino Acid
|
Ser
|
|
Anticodon
|
GCT
|
|
Upstream region at tRNA start position
|
aattattgtt
|
|
tRNA gene sequence
|
GGAGAGGTGGCCGAGCGGCTGAAGGCGCCCGCCTGCTAAGCGGGTATACGGTTTAGAGCC GTATCGAGGGTTCGAATCCCTCTCTCTCCACAA
|
|
Downstream region at tRNA end position
|
ggcttttact
|
| Secondary structure (Cloverleaf model) | >SRA1011023 Ser GCT
t ACAA ggcttttact
G - C
G - C
A - T
G - C
A - T
G - C
G + T T A
T C T C C C A
C G A G | | | | | G
G G C C G G A G G G C
G | | | T T
C A G G C
T G A G TATACGGTTTAGAGCCGTATC
C - G
C - G
C - G
G - C
C - G
C A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |