Sequence ID | >SRA1011335 |
Genome ID | SRR020492.375115 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 124 |
End posion on genome | 199 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
acggttttat |
tRNA gene sequence |
GCTCCTGTAGTGTAGTCCGGTCAAGCATTTAGGCCTTTCACGCCTGAGACTCGGGTTCGA |
Downstream region at tRNA end position |
aagtttaata |
Secondary structure (Cloverleaf model) | >SRA1011335 Glu TTC t ACtc aagtttaata G - C C - G T - A C - G C - G T + G G - C T A T A G C C C A C T G A A | | | | | G C T G T G T C G G G C G + | | + T T G G C A T T C A A T AGAC T + G A - T G - C G - C C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |