| Sequence ID | >SRA1011712 |
| Genome ID | SRR020493.53468 |
| Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
| Species | |
|
Start position on genome
|
105
|
|
End posion on genome
|
182
|
|
Amino Acid
|
Pro
|
|
Anticodon
|
TGG
|
|
Upstream region at tRNA start position
|
aactcatttt
|
|
tRNA gene sequence
|
CGGGGTGTAGCGTAGCCCGGTTATCGCGCCGCGTTTGGGACGCGGAGGTCGCAGGTTCGA ATCCTGCCACCCCGACTA
|
|
Downstream region at tRNA end position
|
gttaatttnn
|
| Secondary structure (Cloverleaf model) | >SRA1011712 Pro TGG
t ACTA gttaatttnn
C - G
G - C
G - C
G - C
G - C
T - A
G - C T A
T C G T C C A
C C G A A | | | | | G
C T G C G G C A G G C
G | | | T T
G T C G C
T T A G AGGTC
C - G
C - G
G - C
C - G
G - C
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |