| Sequence ID | >SRA1011859 |
| Genome ID | SRR020493.99633 |
| Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
| Species | |
|
Start position on genome
|
76
|
|
End posion on genome
|
149
|
|
Amino Acid
|
Cys
|
|
Anticodon
|
GCA
|
|
Upstream region at tRNA start position
|
gcaatcacta
|
|
tRNA gene sequence
|
GGCTGGATGGCAGAGTGGTTATGCAGCGGCCTGCAAAGCCGTTTACGCCGGTTCGATTCC GGCTTCAGCCTCCA
|
|
Downstream region at tRNA end position
|
attattatga
|
| Secondary structure (Cloverleaf model) | >SRA1011859 Cys GCA
a TCCA attattatga
G - C
G - C
C - G
T - A
G - C
G + T
A - T T T
T C G G C C A
G A G | | | | | G
T G A C G G C C G G C
G | | | T T
G A T G C
T T A TTAC
G + T
C - G
G - C
G - C
C - G
C A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |