| Sequence ID | >SRA1011944 |
| Genome ID | SRR020493.130951 |
| Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
| Species | |
|
Start position on genome
|
138
|
|
End posion on genome
|
62
|
|
Amino Acid
|
Pro
|
|
Anticodon
|
TGG
|
|
Upstream region at tRNA start position
|
tttgcatcct
|
|
tRNA gene sequence
|
CGGGGTATAGCGCAGTCTGGTAGCGCACTCGCTTTGGGAGCGAGTGGTCGTAAGTTCGAA TCTTACTACCCCGACCA
|
|
Downstream region at tRNA end position
|
agcgctgtag
|
| Secondary structure (Cloverleaf model) | >SRA1011944 Pro TGG
t ACCA agcgctgtag
C - G
G - C
G - C
G - C
G - C
T - A
A - T T A
T C A T T C A
T G A A | | | | | G
C C G C G G T A A G C
T | | | | T T
G G C G C
G T A A TGGTC
C - G
T - A
C - G
G - C
C - G
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |