| Sequence ID | >SRA1012953 |
| Genome ID | SRR020494.13459 |
| Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
| Species | |
|
Start position on genome
|
77
|
|
End posion on genome
|
2
|
|
Amino Acid
|
Trp
|
|
Anticodon
|
CCA
|
|
Upstream region at tRNA start position
|
nnttatgttt
|
|
tRNA gene sequence
|
ACGGGTTTAGCTCAGTTGGTAGAGCACTGGTCTCCAAAACCAGGTGTCGGGAGTTCGAGT CTCTCAACCCGTGCAA
|
|
Downstream region at tRNA end position
|
annnnnnnnn
|
| Secondary structure (Cloverleaf model) | >SRA1012953 Trp CCA
t GCAA annnnnnnnn
A - T
C - G
G - C
G - C
G - C
T - A
T - A T G
T C T C T C A
T G A A | + | | | G
T C T C G G G G A G C
G | | | | T T
G G A G C
T A A GTGTC
C - G
T - A
G - C
G - C
T - A
C A
T A
C C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |