Sequence ID | >SRA1013141 |
Genome ID | SRR020514.41224 |
Search identical group | |
Phylum/Class | Planktonic microbial communities from Sargasso Sea, BATS Station (SRP001048) |
Species | |
Start position on genome | 67 |
End posion on genome | 150 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tgagccaaaa |
tRNA gene sequence |
GGGGAGATGGCCGAGTGGTTAAAGGCAGCAGACTGTAAATCTGCCGACGAATGTCTACGG |
Downstream region at tRNA end position |
tnnnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1013141 Tyr GTA a ACgc tnnnnnnnnn G - C G - C G - C G - C A - T G - C A - T T A T C T T C C A T G A G | + | | | G G G C C G G G A G G C G | | | T T T A G G C T A A A CGACGAATGTCTAC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |