| Sequence ID | >SRA1013210 |
| Genome ID | SRR020514.71528 |
| Phylum/Class | Planktonic microbial communities from Sargasso Sea, BATS Station (SRP001048) |
| Species | |
|
Start position on genome
|
188
|
|
End posion on genome
|
261
|
|
Amino Acid
|
Gln
|
|
Anticodon
|
CTG
|
|
Upstream region at tRNA start position
|
tgggacatac
|
|
tRNA gene sequence
|
TGGGGATTAGTCTAGTGGTAGGACGACAGACTCTGGCTCTGTAAGCCGAGGTTCGAATCC TCGATCCCCAGCCA
|
|
Downstream region at tRNA end position
|
ctcccttttt
|
| Secondary structure (Cloverleaf model) | >SRA1013210 Gln CTG
c GCCA ctcccttttt
T - A
G - C
G - C
G - C
G - C
A - T
T - A T A
T G C T C C A
G A A | | | | | G
T T C T G C G A G G C
G + | | | T T
G G G A C
T A G AAGC
A - T
C - G
A - T
G - C
A - T
C C
T G
C T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |