Sequence ID | >SRA1013211 |
Genome ID | SRR020514.72070 |
Search identical group | |
Phylum/Class | Planktonic microbial communities from Sargasso Sea, BATS Station (SRP001048) |
Species | |
Start position on genome | 117 |
End posion on genome | 26 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
aaaggagaaa |
tRNA gene sequence |
GGAGAGATGGGTGAGTGGCTTAAACCACAGGTTTGCTAAACCTGCGAAGGATTTAATTTC |
Downstream region at tRNA end position |
tgatttataa |
Secondary structure (Cloverleaf model) | >SRA1013211 Ser GCT a GCCA tgatttataa G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T G A G | | | | | G G G T G G G A G G G C G | | | T T C A A C C T T A A CGAAGGATTTAATTTCTTCC C - G A - T G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |