Sequence ID | >SRA1013313 |
Genome ID | SRR020514.137309 |
Search identical group | |
Phylum/Class | Planktonic microbial communities from Sargasso Sea, BATS Station (SRP001048) |
Species | |
Start position on genome | 77 |
End posion on genome | 152 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tccgaatatg |
tRNA gene sequence |
GTGATCGTAGCTCAGTTGGTAGAGCCCCGGATTGTGATTCCGGTCGTCGTGGGTTCGAGT |
Downstream region at tRNA end position |
gacttgcaat |
Secondary structure (Cloverleaf model) | >SRA1013313 His GTG g CCCA gacttgcaat G - C T - A G - C A - T T + G C - G G - C T G T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A C TCGTC C - G C - G G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |