Sequence ID | >SRA1013449 |
Genome ID | SRR023396.58716 |
Search identical group | |
Phylum/Class | Brazos-Trinity Basin Sediment Metagenome: IODP Site 1320 (SRP001095) |
Species | |
Start position on genome | 258 |
End posion on genome | 184 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
nnnnnnnaac |
tRNA gene sequence |
CGGGGCGTGGCGCAGTCTGGTTAGCGCACAGCGTTCGGGACGCTGGGGTCAGGGGTTCGA |
Downstream region at tRNA end position |
ttcttttata |
Secondary structure (Cloverleaf model) | >SRA1013449 Pro CGG c Attt ttcttttata C - G G - C G - C G - C G - C C - G G - C T A T T C C C C A C T G A G | | | | | G T C G C G A G G G G C G | | | | T T G G C G C T T A A GGGTC C - G A - T G - C C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |