Sequence ID | >SRA1013460 |
Genome ID | SRR023396.71542 |
Search identical group | |
Phylum/Class | Brazos-Trinity Basin Sediment Metagenome: IODP Site 1320 (SRP001095) |
Species | |
Start position on genome | 105 |
End posion on genome | 19 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tctataatgt |
tRNA gene sequence |
GGAGAGGTGCTGGAGTGGCCTATCAGGCGCGCCTGGAGAGCGCGTGTCGGGTTTCCCGAC |
Downstream region at tRNA end position |
tgctttcttt |
Secondary structure (Cloverleaf model) | >SRA1013460 Ser GGA t GCtc tgctttcttt G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A T G A G | | | | | G G G G T C G T G G G C G + | | | T T C T C A G C T A G TGTCGGGTTTCCCGACC C - G G - C C - G G - C C - G C A T G G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |