Sequence ID | >SRA1013570 |
Genome ID | SRR023396.230389 |
Search identical group | |
Phylum/Class | Brazos-Trinity Basin Sediment Metagenome: IODP Site 1320 (SRP001095) |
Species | |
Start position on genome | 117 |
End posion on genome | 41 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
cgcaaacagg |
tRNA gene sequence |
GGGCCGGTCGTCTAGCTCGGTAGGACATTGGCTTTACGAGCCAAAGGTCGCTGGTTCAAG |
Downstream region at tRNA end position |
taacaagcct |
Secondary structure (Cloverleaf model) | >SRA1013570 Val TAC g ACCA taacaagcct G - C G - C G - C C - G C - G G - C G - C T G T C G G C C A C G A C | | + | | A T T C T G G C T G G C C + | | | T T G G G A C G T A A AGGTC T - A T - A G - C G - C C - G T A T G T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |