Sequence ID | >SRA1013591 |
Genome ID | SRR023396.256745 |
Search identical group | |
Phylum/Class | Brazos-Trinity Basin Sediment Metagenome: IODP Site 1320 (SRP001095) |
Species | |
Start position on genome | 221 |
End posion on genome | 150 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
atttttggat |
tRNA gene sequence |
GGGCCTGTAGTATAATGGTAGAACACCGCTCTCACACGGCGGGGGTTCCGGTTCGAATCC |
Downstream region at tRNA end position |
ctttagtgtt |
Secondary structure (Cloverleaf model) | >SRA1013591 Val CAC t ACtt ctttagtgtt G - C G - C G - C C - G C - G T - A G - C T A T G G G C C A A A A + | | | | G T T A T G T C C G G C G + | | T T G G A A C T A A GGGT C - G C - G G - C C - G T + G C C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |