| Sequence ID | >SRA1013857 |
| Genome ID | SRR023774.112134 |
| Phylum/Class | Tampa Bay phage from induction experiment (SRP001112) |
| Species | |
| Start position on genome | 30 |
| End posion on genome | 116 |
| Amino Acid | Leu |
| Anticodon | TAA |
| Upstream region at tRNA start position |
cttgattttT |
| tRNA gene sequence |
GGGAGTGTGGCGGAATCGGTAGACGCACCAGACTTAAAATCTGTTGAACATTAAGTTCGT |
| Downstream region at tRNA end position |
cccccctaaa |
| Secondary structure (Cloverleaf model) | >SRA1013857 Leu TAA
T ATta cccccctaaa
G + T
G - C
G - C
A - T
G - C
T - A
G - C T G
T C C C C C A
T A A G | | | | | A
C G G C G G G G G G C
G | | | T T
G A C G C
T A G A TGAACATTAAGTTCGT
C T
C - G
A - T
G - C
A - T
C A
T A
T A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |