Sequence ID | >SRA1013859 |
Genome ID | SRR023774.118274 |
Search identical group | |
Phylum/Class | Tampa Bay phage from induction experiment (SRP001112) |
Species | |
Start position on genome | 74 |
End posion on genome | 2 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
attatcttga |
tRNA gene sequence |
GGGGTTATAGCTCAATCGGTAGAGCGCCTGCTTTGCAAGCAGGAGGTTTGGGGTTCGATT |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1013859 Ala TGC a Atnn nnnnnnnnnn G - C G - C G + T G - C T - A T - A A - T T T T A C C C C A T A A A | | | | | G C C T C G T G G G G C G | | | | T T G G A G C T A G AGGTT C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |