Sequence ID | >SRA1013892 |
Genome ID | SRR023774.275223 |
Search identical group | |
Phylum/Class | Tampa Bay phage from induction experiment (SRP001112) |
Species | |
Start position on genome | 23 |
End posion on genome | 100 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aaatgcttaG |
tRNA gene sequence |
CTTCCCTTAGCTCAGATGGTTAGAGCAGTAGACTGTTAATCTATTAGTCCCAGGTTCGAG |
Downstream region at tRNA end position |
aannnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1013892 Asn GTT G GCAA aannnnnnnn C C T + G T - A C - G C - G C - G T - A T G T G G T C C A A G A A | | | | | G T C T C G C C A G G C G | | | | T T G G A G C T T A A TAGTC G + T T - A A - T G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |