Sequence ID | >SRA1013912 |
Genome ID | SRR023820.12509 |
Search identical group | |
Phylum/Class | Pru Toh Daeng peat swamp (SRP001114) |
Species | |
Start position on genome | 156 |
End posion on genome | 84 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
attgcgaagt |
tRNA gene sequence |
TTGGGGATAGTTCAACGGTAGAACAGCGGACTCTGACTCCGTTAATCTTGGTTCGAATCC |
Downstream region at tRNA end position |
cggctgcccc |
Secondary structure (Cloverleaf model) | >SRA1013912 Gln CTG t CCAc cggctgcccc T + G T - A G - C G - C G - C G - C A - T T A T G G A C C A A A A | + | | | G C C T T G C T T G G C G | | | | T T G G A A C T A A TAAT G + T C - G G - C G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |