| Sequence ID | >SRA1014005 |
| Genome ID | SRR023821.36122 |
| Phylum/Class | Pru Toh Daeng peat swamp (SRP001114) |
| Species | |
| Start position on genome | 166 |
| End posion on genome | 90 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
cgagccaaat |
| tRNA gene sequence |
GCGCCCGTAGCTCAGTTGGATAGAGCACTTGGCTACGAACCAAGGGGTCGGGAGTTCGAA |
| Downstream region at tRNA end position |
ccttcatttt |
| Secondary structure (Cloverleaf model) | >SRA1014005 Arg ACG
t ACCA ccttcatttt
G - C
C - G
G - C
C - G
C - G
C - G
G - C T A
T C T C T C A
T G A A | + | | | G
T C T C G G G G A G C
G | | | | T T
G G A G C
A T A A GGGTC
C - G
T - A
T - A
G - C
G - C
C A
T A
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |