Sequence ID | >SRA1014017 |
Genome ID | SRR023821.41387 |
Search identical group | |
Phylum/Class | Pru Toh Daeng peat swamp (SRP001114) |
Species | |
Start position on genome | 247 |
End posion on genome | 174 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
acgggtattt |
tRNA gene sequence |
TGGGGGATCGTCTAATGGTAGGACTGCAGACTCTGACTCTGCCTGTCTAGGTTCGAATCC |
Downstream region at tRNA end position |
gccggtcagg |
Secondary structure (Cloverleaf model) | >SRA1014017 Gln CTG t GCCA gccggtcagg T - A G - C G - C G - C G - C G - C A - T T A T G A T C C A A A C | | | | | G T T C T G C T A G G C G + | | | T T G G G A C T A T CTGT G - C C - G A - T G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |