Sequence ID | >SRA1014026 |
Genome ID | SRR023821.43440 |
Search identical group | |
Phylum/Class | Pru Toh Daeng peat swamp (SRP001114) |
Species | |
Start position on genome | 219 |
End posion on genome | 138 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gccggatgtc |
tRNA gene sequence |
GCGAGGATGGCGGAGTTGGCAGACGCGCCAGACTTAGGATCTGGTAGGGTAACCTGTGGG |
Downstream region at tRNA end position |
ggggaaggaa |
Secondary structure (Cloverleaf model) | >SRA1014026 Leu TAG c Ataa ggggaaggaa G - C C - G G - C A - T G - C G - C A - T T G T C C C C C A T G A G | | | | | G T G G C G G G G G G C G | | | T T G A C G C C A G G TAGGGTAACCTGT C - G C - G A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |