Sequence ID | >SRA1014093 |
Genome ID | SRR023821.95118 |
Search identical group | |
Phylum/Class | Pru Toh Daeng peat swamp (SRP001114) |
Species | |
Start position on genome | 136 |
End posion on genome | 62 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ccgactgacc |
tRNA gene sequence |
GATCTCGTGGGGCAGCCTGGAGTGCCCGTCACCTTGACATGGTGAAGGCCGCTGGTTCAA |
Downstream region at tRNA end position |
ctctaccgcc |
Secondary structure (Cloverleaf model) | >SRA1014093 Val GAC c Attt ctctaccgcc G - C A - T T - A C - G T - A C - G G - C T A T C G A C C A C C G A G | | | | | A T C G G G G C T G G C G | | | | T T G G C C C A G T G AGGCC T - A C - G A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |