Sequence ID | >SRA1014115 |
Genome ID | SRR023845.5490 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 143 |
End posion on genome | 228 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tcctgttccT |
tRNA gene sequence |
GGGTCGATGCCCGAGCGGTTAATGGGGACGGACTGTAAATTCGTTGGCAATATGTCTACG |
Downstream region at tRNA end position |
atttgccaat |
Secondary structure (Cloverleaf model) | >SRA1014115 Tyr GTA T AAta atttgccaat G - C G - C G - C T + G C - G G - C A - T T A T C G A C C A C G A G | | | | | A G G C C C G C T G G C G + | | | T T T T G G G T A A G TGGCAATATGTCTAC A - T C - G G - C G + T A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |