Sequence ID | >SRA1014123 |
Genome ID | SRR023845.9034 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 174 |
End posion on genome | 245 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
cacaataaac |
tRNA gene sequence |
GGGAAAATAGTTCAACGGTAGAATAGCGAGCTTGCACCTCGCGGGTCGGTGTTCAATTCA |
Downstream region at tRNA end position |
tacagccttt |
Secondary structure (Cloverleaf model) | >SRA1014123 Ala TGC c ACtc tacagccttt G - C G - C G + T A - T A - T A - T A - T T T T G C C A C A A A A | | | | | A C C T T G C G G T G C G | | | + T T G G A A T T A A GGGT G - C C - G G - C A - T G - C C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |